Email to potential suppliers of a degenerate USS oligonucleotide

Dear oligonucleotide expert,

I'm writing to inquire about ordering a large highly degenerate oligonucleotide.

We're hoping to obtain an oligonucleotide that will be about 50 nt long and 12% degenerate at every position (so this will really be a population of degenerate nucleotides). Below I've listed specifications.

Would you be able to synthesize such an oligonucleotide for us? If so, could you let me know the estimated cost and time frame, and any other issues you think we should consider?

Thanks very much,

Rosie Redfield

Sequence: Not yet finalized, but probably similar to: AAAGTGCGGTTAATTTTTACAGTATTTTTACTGGTACCATATGAATTCCA

Degeneracy: Every position should be degenerate, with 4% each of the three other bases. For example, every position specified as an A should be 88% A and 4% each of T, G and C.

Scale: Because synthesizing this oligo will probably require a dedicated run, we would like to obtain as much as can easily be prepared in a single run.

(Calculation: 1 micromole of a 50 nt fragment is 6.02 x 10^17 molecules, with mass = 15 mg.)

Modifications: None.

Purification: For our experiments it will important to minimize the fraction of oligos that are not full length. What purification methods do you recommend for oligos of this length, and what contamination level should we expect?